Enter two sequences to be compared below in the fields below. Input must be in FASTA format.
Examples:
CCCACUAUCGUUAACGAUAGCUGGUCCUAC
CCAACAAUGGUUAACGACAGAUCGUCCUAU






Developed by Fumba Chibaka - www.fumba.me